View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19687_low_67 (Length: 231)
Name: NF19687_low_67
Description: NF19687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19687_low_67 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 23 - 213
Target Start/End: Complemental strand, 7364540 - 7364350
Alignment:
| Q |
23 |
taggagagggtgatgaagtagtattttgagggggtgtagaaagttctgggaggttaagttttgcatcagaaccataaagtttacgagcagcagcatcata |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7364540 |
taggagagggtgatgaagtagtattttgagggggtgtagaaagttctgggaggttaagttttgcatcagaaccataaagtttacgagcagcagcatcata |
7364441 |
T |
|
| Q |
123 |
agctaaagcagcttcatgagaggtttcaaaagtaccaagccaaagacgagcaccacgattaggttcgcggatttcagccacccatttaccc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7364440 |
agctaaagcagcttcatgagaggtttcaaaagtaccaagccaaagacgagcaccacgattaggttcgcgaatttcagccacccatttaccc |
7364350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 94 - 213
Target Start/End: Complemental strand, 52690676 - 52690557
Alignment:
| Q |
94 |
ccataaagtttacgagcagcagcatcataagctaaagcagcttcatgagaggtttcaaaagtaccaagccaaagacgagcaccacgattaggttcgcgga |
193 |
Q |
| |
|
|||||||| ||| | || |||||||||||||| |||||||||||| | || || ||||| || ||||||||||| |||| ||||||||| ||||| |||| |
|
|
| T |
52690676 |
ccataaagcttaagtgcggcagcatcataagccaaagcagcttcaagggatgtctcaaatgtcccaagccaaaggcgagaaccacgattgggttcacgga |
52690577 |
T |
|
| Q |
194 |
tttcagccacccatttaccc |
213 |
Q |
| |
|
||||||| |||||||||||| |
|
|
| T |
52690576 |
tttcagcaacccatttaccc |
52690557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University