View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19688_low_2 (Length: 320)
Name: NF19688_low_2
Description: NF19688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19688_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 105 - 308
Target Start/End: Complemental strand, 51844413 - 51844210
Alignment:
| Q |
105 |
cttggaattgggtagccacaaacggaaacatgaaagttgtcatcgtgtgtgagaacagattggtgatggaggcttcaacttttagaattaccaatattgg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51844413 |
cttggaattgggtagccacaaacggaaacatgaaagttgtcatcgtgtgtgagaacagattggtgatggaggcttcaacttttagaattaccaatattgg |
51844314 |
T |
 |
| Q |
205 |
attttaattctaattatagttaaatttacaattggattgaattcattcagannnnnnngctatttttaacatcttctattcgttgaccggctaccttcat |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51844313 |
attttaattctaattatagttaaatttacaattggattcaattcattcagatttttttgctatttttaacatcttctattcgttgaccggctaccttcat |
51844214 |
T |
 |
| Q |
305 |
ttca |
308 |
Q |
| |
|
|||| |
|
|
| T |
51844213 |
ttca |
51844210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University