View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19688_low_3 (Length: 274)
Name: NF19688_low_3
Description: NF19688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19688_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 16 - 258
Target Start/End: Original strand, 6499419 - 6499673
Alignment:
| Q |
16 |
atcattatattcttccttaacatgaatgaattgtaggcaacctataccacataatttgct------------ttttaaaaagcagcatttcattgaaaac |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
6499419 |
atcattatattcttccttaacatgaatgaattgtaggcaacctataccacataatttgctcgtgattttgcttttgaaaaagcagcatttcattgaaaac |
6499518 |
T |
|
| Q |
104 |
cttggaagcatttgcataaccaatagagaaaatatcatcccctcatcatttatccataaataaatatttcaataaaagacatttttcaaaacataacaaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6499519 |
cttggaagcatttgcataaccaatagagaaaatatcatcccctcatcatttatccataaataaatatttcaataaaagacatttttcaaaacataacaaa |
6499618 |
T |
|
| Q |
204 |
ttaaatttttagacatctataaacttctttaagagaatatatgtaacaaacaagt |
258 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6499619 |
ttaaatttttagacatctataaacttccttaagagaatatatgtaacaaacaagt |
6499673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University