View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19689_low_16 (Length: 245)
Name: NF19689_low_16
Description: NF19689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19689_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 41990600 - 41990824
Alignment:
| Q |
1 |
tttgttgtttccacgtgcctcacttgtttgtacataaatgttaaaatatttttactatcttggtatgcatatgaagtaaaattttactacaatttcaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41990600 |
tttgttgtttccacgtgcctcacttgtttgta--taaatgttaaaatatttttactatcttggtatgcatatgaagtaaaattttactacaatttcaata |
41990697 |
T |
|
| Q |
101 |
cttaaacaaaacaattattggacataatttgtttacttttcgatcaaatatcaatcttaccacaaagtcaatttactcgtaaacaatttttggataaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41990698 |
cttaaacaaaacaattattggacataatttgtttacttttagatcaaatatcgatcttaccacaaagtcaatttactcgtaaacaatttttggataaact |
41990797 |
T |
|
| Q |
201 |
ttatttactttccgatcaacctttttc |
227 |
Q |
| |
|
|||||||||||||||||||| |||||| |
|
|
| T |
41990798 |
ttatttactttccgatcaacatttttc |
41990824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University