View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1968_1D_high_10 (Length: 426)
Name: NF1968_1D_high_10
Description: NF1968_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1968_1D_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 413; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 413; E-Value: 0
Query Start/End: Original strand, 3 - 419
Target Start/End: Original strand, 28199533 - 28199949
Alignment:
| Q |
3 |
ttggtgttcttggtgcatgttctcatggaggttttgtagatgaggggaaaaagttatttgaaatgatgagacatacttatcatttaaagccaaacatgga |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28199533 |
ttggtgttcttggtgcatgttctcatggaggttttgtagatgaggggaaaaagttatttgaaatgatgagacatacttatcatttaaagccaaacatgga |
28199632 |
T |
 |
| Q |
103 |
gcattatggatgcatggttgatctccttggtcgagcaggatgtttggaagatgcaaaacaaattattgataatatgccaatgaagcctagccctggtgtc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28199633 |
gcattatggatgcatggttgatctccttggtcgagcaggatgtttggaagatgcaaaacaaattattgataatatgccaatgaagcctagccctggtgtc |
28199732 |
T |
 |
| Q |
203 |
ttgggagctttattaggtgcctgcgtgagccacaaagatttcgtaatgggcgaacatatagggaacattctggttaatctacagcagaaccacagcactg |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28199733 |
ttgggagctttattaggtgcctgcgtgagccacaaagatttcgtaatgggcgaacatatagggaacattctggttaatctacagcagaaccacaacactg |
28199832 |
T |
 |
| Q |
303 |
gatatgcacttctggcaaacttgtattcaacgtgtcaaaactgggaagcagtagcgcgtgtcaggaagctcatgaaaggaacgcaggttgaaaagactcc |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28199833 |
gatatgcacttctggcaaacttgtattcaacgtgtcaaaactgggaagcagtagcgcgtgtcaggaagctcatgaaaggaacgcaggttgaaaagactcc |
28199932 |
T |
 |
| Q |
403 |
aggttatagttggatag |
419 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
28199933 |
aggttatagttggatag |
28199949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University