View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1968_1D_low_20 (Length: 307)
Name: NF1968_1D_low_20
Description: NF1968_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1968_1D_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 4e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 21 - 226
Target Start/End: Original strand, 34419965 - 34420170
Alignment:
| Q |
21 |
cattcgaattgtacttgtgtgacataataccaaatgacattggtcaatttaaatgtggcacatgttaatacaannnnnnnaaacataaaaatatgggaaa |
120 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34419965 |
cattcgaattgtacttgtgtgacataatatcaaatgacattggtcaatttaaatgtggcacatgttaatacaatttttttaaacataaaaatatgggaaa |
34420064 |
T |
|
| Q |
121 |
gagagaggnnnnnnnntaatagttgaattggcttatgtgtcacagttaaattgatcaatattaatgtcatttatgtcttaatggtatgcaagcggagtct |
220 |
Q |
| |
|
|||||||| ||| |||||||||| ||||||||||| | ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
34420065 |
gagagaggaaaaaaaataacagttgaattgacttatgtgtcataattaaattgatcaatattaatgtcatttatatcttaatggtacgcaagcggagtct |
34420164 |
T |
|
| Q |
221 |
atacca |
226 |
Q |
| |
|
|||||| |
|
|
| T |
34420165 |
atacca |
34420170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 138 - 204
Target Start/End: Complemental strand, 47376321 - 47376255
Alignment:
| Q |
138 |
aatagttgaattggcttatgtgtcacagttaaattgatcaatattaatgtcatttatgtcttaatgg |
204 |
Q |
| |
|
||||||||||| | |||||||||||| ||| |||||||| ||| |||| ||||| ||||||||||| |
|
|
| T |
47376321 |
aatagttgaatcgatttatgtgtcacaattagattgatcagtatcaatgacatttctgtcttaatgg |
47376255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 192
Target Start/End: Original strand, 30244820 - 30244872
Alignment:
| Q |
140 |
tagttgaattggcttatgtgtcacagttaaattgatcaatattaatgtcattt |
192 |
Q |
| |
|
||||||||||| ||||||||||||| ||| |||||||||| | |||| ||||| |
|
|
| T |
30244820 |
tagttgaattgacttatgtgtcacaattagattgatcaatgtcaatgacattt |
30244872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University