View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1968_1D_low_29 (Length: 252)
Name: NF1968_1D_low_29
Description: NF1968_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1968_1D_low_29 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 22 - 252
Target Start/End: Original strand, 38869215 - 38869445
Alignment:
| Q |
22 |
tcaccttcccaccaagggaaacaaccttcctatcttcaacctttttgcgctctttccatgtcatatgcgagttgcctaagatatattgcaatgagtagcc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38869215 |
tcaccttcccaccaagggaaacaaccttcctatcttcaacctttttgcgctctttccatgtcatatgcgagttgcctaagatatattgcaatgagtagcc |
38869314 |
T |
|
| Q |
122 |
attataaaaaagaaggtaacaaatcaggtgaatatgcttaccataaattatttaactccaacaccccaaatttaaaataatgaatgaacaaatattttgt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38869315 |
attataaaaaagaaggtaacaaatcaggtgaatatgcttaccataaattatttaactccaacaccccaaatttaaaataatgaatgaacaaatattttgt |
38869414 |
T |
|
| Q |
222 |
acttagcattcaaattcgttcttatcattta |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38869415 |
acttagcattcaaattcgttcttatcattta |
38869445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University