View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1968_1D_low_40 (Length: 213)
Name: NF1968_1D_low_40
Description: NF1968_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1968_1D_low_40 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 21 - 213
Target Start/End: Complemental strand, 12763043 - 12762851
Alignment:
| Q |
21 |
acaaacacaaacacaaggtgattggtctaagaaattaccgtctttgcaagaatataaacaatcatattcgtttgttgcttaaaagactttacttcaaagt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12763043 |
acaaacacaaacacaaggtgattggtctaagaaattaccgtctttgcaagaatataaacaatcatatttgtttgttgcttaaaagactttacttcaaagt |
12762944 |
T |
|
| Q |
121 |
taggattagctaaaatactagaaattgtagaactaaatcagatactctagtagatcattgtcggatggtcttcacaagaatttgagaaccatt |
213 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12762943 |
taggattagctaaaatactagaaattgaagaactaaatcagatactctagtagatcattgtcggatggtcttcacaagaatttgagaaacatt |
12762851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 21 - 205
Target Start/End: Complemental strand, 12702043 - 12701859
Alignment:
| Q |
21 |
acaaacacaaacacaaggtgattggtctaagaaattaccgtctttgcaagaatataaacaatcatattcgtttgttgcttaaaagactttacttcaaagt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12702043 |
acaaacacaaacacaaggtgattggtctaagaaattaccgtctttgcaagaatataaacaatcatatttgtttgttgcttaaaagactttacttcaaagt |
12701944 |
T |
|
| Q |
121 |
taggattagctaaaatactagaaattgtagaactaaatcagatactctagtagatcattgtcggatggtcttcacaagaatttga |
205 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12701943 |
taggattagctaaaatactagaaattgaagaactaaatcagatactctagtagatcattgtcggatggtcttcacaagaatttga |
12701859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University