View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1968_1D_low_44 (Length: 206)
Name: NF1968_1D_low_44
Description: NF1968_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1968_1D_low_44 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 34420794 - 34420982
Alignment:
| Q |
1 |
gaccaaaacattagacagaca-----cgacacatacatagtctttttactcgtaaacaaaatgttgagccacttttaaacttgattttgtttggaatttg |
95 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34420794 |
gaccaaaacattagacagacacgacacgacacatacatactctttttactcgtaaacaaaatgttgagccacttttaaacttgattttgtttggaatttg |
34420893 |
T |
 |
| Q |
96 |
atcaagagatttactggcataaacactgcaatattgcataattattttgaacaatatttattatagaaacttgtttcaaaaataaattt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34420894 |
atcaagagatttactggcataaacactgcaatattgcataattattttgaacaatatttattatagaaacttgtttaaaaaataaattt |
34420982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University