View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1968_1D_low_46 (Length: 205)
Name: NF1968_1D_low_46
Description: NF1968_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1968_1D_low_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 39240737 - 39240528
Alignment:
| Q |
1 |
tggaaaaatcgagcactcttaatctaaaaacccacacagtcactatcggaaagaggacaaagacaatgcaattatccaaatgtgattgt----------- |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39240737 |
tggaaaaatcgagcactcttaatctaaaaacccacacagtcactatcggaaagaggacaaagacaatgcaattatctaaatgtgattgtggtatgcttta |
39240638 |
T |
 |
| Q |
90 |
ttatgacttatccatacttttcagtatacaacaatgataggagtaagcttgcacctttcagttttcactaccacagcagaaaataaaattataaatattg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39240637 |
ttatgacttatccatacttttcagtatacaacaatgataggagtaagcttgcacttttcagttttcactaacacagcagaaaataaaattataaatattg |
39240538 |
T |
 |
| Q |
190 |
tgattgttat |
199 |
Q |
| |
|
|||||||||| |
|
|
| T |
39240537 |
tgattgttat |
39240528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University