View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19690_high_13 (Length: 269)
Name: NF19690_high_13
Description: NF19690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19690_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 129 - 256
Target Start/End: Complemental strand, 25379115 - 25378988
Alignment:
| Q |
129 |
tactactgctactagctccgtgtcagcgatctctgaggacccttcttcaaaccaatcttcctttgttttttctaacctatctcatgaaaattcatcatca |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25379115 |
tactactgctactagctccgtgtcagcgatctctgaggacccttcttcaaaccaatcttcctttgttttttctaacctatctcatgaaaattcatcatca |
25379016 |
T |
|
| Q |
229 |
ccacttatatctgaatcttatgatgatg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
25379015 |
ccacttatatctgaatcttatgatgatg |
25378988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 21 - 138
Target Start/End: Complemental strand, 25379256 - 25379139
Alignment:
| Q |
21 |
aaattcaaggagaaagaacaaaaggcctcaaaccactgatggtaaaccacaatcttctattcttcaagactatatcaaaactttgactactcaaaaagcg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25379256 |
aaattcaaggagaaagaacaaaaggcctcaaaccactgatggtaaaccacaatcttctattcttcaagactatatcaaaactttgactactcaaaaagcg |
25379157 |
T |
|
| Q |
121 |
ttcatcagtactactgct |
138 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
25379156 |
ttcatcagtactactgct |
25379139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University