View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19690_high_14 (Length: 236)
Name: NF19690_high_14
Description: NF19690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19690_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 17 - 220
Target Start/End: Original strand, 1716482 - 1716683
Alignment:
| Q |
17 |
atatacctaggccgtcacaaattagttacaacaatgttactgtgaagctactatttttctactcaaaatttggctcaaagttttcaaagcaaccattttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1716482 |
atatacctaggccgtcacaaattagttacaacaatgtttctgtgaagctactatttttctactcaaaatttggctcaaagttttcaaagcaaccattttt |
1716581 |
T |
 |
| Q |
117 |
cacattctcattctcagtttcttaacaaagatttgagctttttgaagaatatagtgtcaaactcaaacccatgatgaacaaagacaccatcatggaggtg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1716582 |
cacattctcattctcagtttcttaacaaagatttgagctttttgaaga--atagtgtcaaactcaaacccatgatgaacaaagacaccatcatggaggtg |
1716679 |
T |
 |
| Q |
217 |
aggg |
220 |
Q |
| |
|
|||| |
|
|
| T |
1716680 |
aggg |
1716683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University