View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19690_low_17 (Length: 204)

Name: NF19690_low_17
Description: NF19690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19690_low_17
NF19690_low_17
[»] chr5 (1 HSPs)
chr5 (75-155)||(4323393-4323473)


Alignment Details
Target: chr5 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 75 - 155
Target Start/End: Complemental strand, 4323473 - 4323393
Alignment:
75 tgcattagaaaaccttgttcaaaaatgtaattcctctttcataaataaacaatacaaattatttacttcatatgaacgtat 155  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4323473 tgcattagaaaaccttgttcaaaaatgtaattcctctttcataaataaacaatacaaattatttacttcatatgaacgtat 4323393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University