View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19692_low_11 (Length: 310)
Name: NF19692_low_11
Description: NF19692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19692_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 18 - 259
Target Start/End: Complemental strand, 37195822 - 37195581
Alignment:
| Q |
18 |
caagagactagagaatgaaaggggtacttgaattgaacaagtactcgtacttaaagtgaccaaatagcatcatgtgacagccaactttagatatatacat |
117 |
Q |
| |
|
||||||| ||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37195822 |
caagagagtagagaatgaagggggtacttgaaatgaacaagtactcgtacttaaagtgaccaaatagcatcatgtgacagccaactttagatacatacat |
37195723 |
T |
|
| Q |
118 |
ctttctctgaccatttccacactatggctgccctttcctttcatctatagtttcatgtggtgtataacttaatttaatgtgaaccacaaaattttgacaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37195722 |
ctttctctgaccatttccacactatggctgccctttcctttcatctatagtttcatgttgtgtataacttaatttaatgtgaaccacaaaattttgacaa |
37195623 |
T |
|
| Q |
218 |
ttggatccatgatatcgattatttgtgaggaaaatatatatt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37195622 |
ttggatccatgatatcgattatttgtgaggaaaatatatatt |
37195581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University