View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19692_low_15 (Length: 242)
Name: NF19692_low_15
Description: NF19692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19692_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 20 - 223
Target Start/End: Complemental strand, 52087703 - 52087500
Alignment:
| Q |
20 |
agaagacgttccacaatcagcgattgattccatggtgaagcaagtgaattcccttatctctcttgaagagccacttcacttgactatgggtccgttggta |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52087703 |
agaagacgttccacaatcagcgattgattccatggtgaagcaagtgaattcccttatctctcttgaagagccacttcacttaactatgggtccgttggta |
52087604 |
T |
 |
| Q |
120 |
agtattcaatcctccaattccatttcatctttcaatttcactcacatgatccatagtagattcagatccaaggaagatctccatgcctatgcagtgcacc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52087603 |
agtattcaatcctccaattccatttcatctttcaatttcactcacatgatccatagtagattcagatccaaggaagatctccatgcctatgcagtgcacc |
52087504 |
T |
 |
| Q |
220 |
ctac |
223 |
Q |
| |
|
|||| |
|
|
| T |
52087503 |
ctac |
52087500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University