View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19692_low_18 (Length: 227)
Name: NF19692_low_18
Description: NF19692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19692_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 5 - 215
Target Start/End: Complemental strand, 1318604 - 1318394
Alignment:
| Q |
5 |
agagatagagaaaaacatacactctcacacgaggctgcaccaaaatcagggaccattcaccactaatgaaatgatttatggtcattgtgataatcaagaa |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1318604 |
agagatagagaaaaacatacactctcacacgaggctgcaccaaaatcagtgaccagtcaccactaatgaaatgatttattgtcattgtgataatcaagaa |
1318505 |
T |
 |
| Q |
105 |
gcaagccaaattgaaaagattaataaattggaagattttggtttctgaagagattggtagaaagatttgagctagcaaagaagaaaattttggtgttgta |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
1318504 |
gcaagccaaattgaaaagattaataaattggaagattttggtttctgaagagattggttgaaagatttgagctagcaaagaagaaaattttggtgttgga |
1318405 |
T |
 |
| Q |
205 |
ttttgtgatga |
215 |
Q |
| |
|
|||||| |||| |
|
|
| T |
1318404 |
ttttgtaatga |
1318394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University