View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19693_high_4 (Length: 287)

Name: NF19693_high_4
Description: NF19693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19693_high_4
NF19693_high_4
[»] chr1 (1 HSPs)
chr1 (31-272)||(40899674-40899915)


Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 31 - 272
Target Start/End: Original strand, 40899674 - 40899915
Alignment:
31 atgaacttataaatataccagtaagatcacgatagacaaaggctgtaatgccattgaaaagcaaagttattgagtcttgaagatgtgatcaatatgctca 130  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40899674 atgaacttataaatataccagtaagatcacgatagacaaaggctgtaatgccattgaaaagcaaagttattgagtcttgaagatgtgatcaatatgctca 40899773  T
131 gttgatatctgcattggaaactcaataaaatcatattcatgtaaatattgaatggtgaaaacactataagctcttacaatcagtaagttggcaaccaaaa 230  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40899774 gttgatatctacattggaaactcaataaaatcatattcatgtaaatattgaatggtgaaaacactataagctcttacaatcagtaagttggcaaccaaaa 40899873  T
231 atattaacatacataataaatggcatgacattatgagaaagt 272  Q
    ||||||||||||||||||||||||||||||||||||||||||    
40899874 atattaacatacataataaatggcatgacattatgagaaagt 40899915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University