View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19693_high_6 (Length: 252)
Name: NF19693_high_6
Description: NF19693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19693_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 38842567 - 38842423
Alignment:
| Q |
1 |
agtggtattttttgtatcactgccacataagcatcgcttttaaggaataatatataataaatcttggatggataacttacttgattgagggtttaaataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38842567 |
agtggtattttttgtatcactgccacataagcatcgcttttaaggaataatatataataaatcttggatggataacttacttgattgagggtttaaataa |
38842468 |
T |
 |
| Q |
101 |
gttaaaggttgagggtgtaaatcctgacaaagtgaaaaactgtta |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38842467 |
gttaaaggttgagggtgtaaatcctgacaaagtgaaaaactgtta |
38842423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 144 - 181
Target Start/End: Complemental strand, 38842163 - 38842126
Alignment:
| Q |
144 |
taagataacaattaaattaacctactaatatttgtcag |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38842163 |
taagataacaattaaattaacctactaatatttgtcag |
38842126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University