View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19693_low_4 (Length: 287)
Name: NF19693_low_4
Description: NF19693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19693_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 31 - 272
Target Start/End: Original strand, 40899674 - 40899915
Alignment:
| Q |
31 |
atgaacttataaatataccagtaagatcacgatagacaaaggctgtaatgccattgaaaagcaaagttattgagtcttgaagatgtgatcaatatgctca |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40899674 |
atgaacttataaatataccagtaagatcacgatagacaaaggctgtaatgccattgaaaagcaaagttattgagtcttgaagatgtgatcaatatgctca |
40899773 |
T |
 |
| Q |
131 |
gttgatatctgcattggaaactcaataaaatcatattcatgtaaatattgaatggtgaaaacactataagctcttacaatcagtaagttggcaaccaaaa |
230 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40899774 |
gttgatatctacattggaaactcaataaaatcatattcatgtaaatattgaatggtgaaaacactataagctcttacaatcagtaagttggcaaccaaaa |
40899873 |
T |
 |
| Q |
231 |
atattaacatacataataaatggcatgacattatgagaaagt |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40899874 |
atattaacatacataataaatggcatgacattatgagaaagt |
40899915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University