View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19693_low_7 (Length: 240)
Name: NF19693_low_7
Description: NF19693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19693_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 226
Target Start/End: Complemental strand, 6352554 - 6352345
Alignment:
| Q |
18 |
acaagctacccgtatcttttattcatgtgggggcctaattttgaagctgtcattttatatagcattaaaatgacaagtggccatgtttcaattctacctc |
117 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6352554 |
acaagctacccgtatcttttcttcatgtgggggcctaattttgaagctgtcattttatagagcattaaaatgacaagtggccatgtttcaattctacctc |
6352455 |
T |
 |
| Q |
118 |
taccatgaatagttggtagtaggacatgcaaaagatattatgg-aaaatactaaaagctaccaatggggtgtataattaggttgcaaattgctatagcta |
216 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6352454 |
taccgtgaatagttggtagtaggacatgcaaaagatattatggtaaaatactaaaagcaaccaatggggtgtataattaggttgcaaattgctatagcta |
6352355 |
T |
 |
| Q |
217 |
tacatgcttc |
226 |
Q |
| |
|
|||||||||| |
|
|
| T |
6352354 |
tacatgcttc |
6352345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University