View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19695_low_13 (Length: 291)
Name: NF19695_low_13
Description: NF19695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19695_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 101 - 174
Target Start/End: Original strand, 6697426 - 6697499
Alignment:
| Q |
101 |
gactacattaaatctaatttccactaactcattgtagtatttataatgtgtcacaatttcaacaacatgtttaa |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || || |||||||| |
|
|
| T |
6697426 |
gactacattaaatctaatttccactaactcattgtagtatttataatgtgtcagaattttaagaagatgtttaa |
6697499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University