View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19696_high_12 (Length: 252)
Name: NF19696_high_12
Description: NF19696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19696_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 9412563 - 9412331
Alignment:
| Q |
1 |
cagctatgcagttcagtcatcaacaaaaaagaagacgaaaaacaacaacggttgtttctgccgatgctgatttttatttacctgatgaatgttgggaaag |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9412563 |
cagccatgcagttcagtcatcaacaaaaaagaagacgaaaaacaacaacggttgttgttgccgatg---atttttatttacctgatgaatgttgggaaag |
9412467 |
T |
 |
| Q |
101 |
tatcttcaaattcctcaacaatggtgctaactatcgcgacttgaagtctctctcgcttgtctccaagttgtttctctccatcaccaaccgtcttttcatc |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9412466 |
tatcttcaaattcctcaacgatggtgctaactatcgcgagttgaagtctctctcgcttgtctccaagttgtttctctccatcaccaaccgtcttgtcatc |
9412367 |
T |
 |
| Q |
201 |
tcacttacggtctacaacaacggaataggtcctttt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
9412366 |
tcacttacggtctacaacaacggaataggtcctttt |
9412331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 65 - 124
Target Start/End: Complemental strand, 7561391 - 7561332
Alignment:
| Q |
65 |
tgctgatttttatttacctgatgaatgttgggaaagtatcttcaaattcctcaacaatgg |
124 |
Q |
| |
|
|||||||||||||||||||||||| |||||| || | ||||||| |||||||||||||| |
|
|
| T |
7561391 |
tgctgatttttatttacctgatgactgttggaaacatgtcttcaagttcctcaacaatgg |
7561332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 66 - 126
Target Start/End: Complemental strand, 7555572 - 7555512
Alignment:
| Q |
66 |
gctgatttttatttacctgatgaatgttgggaaagtatcttcaaattcctcaacaatggtg |
126 |
Q |
| |
|
|||| |||||||||||| |||||||||||| || | |||||||||| |||||||| |||| |
|
|
| T |
7555572 |
gctgctttttatttacccgatgaatgttggcaacttgtcttcaaatttctcaacaacggtg |
7555512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 70 - 117
Target Start/End: Original strand, 51120325 - 51120372
Alignment:
| Q |
70 |
atttttatttacctgatgaatgttgggaaagtatcttcaaattcctca |
117 |
Q |
| |
|
|||| |||||||||||||| ||||||||| || ||||||||||||||| |
|
|
| T |
51120325 |
atttctatttacctgatgactgttgggaatgtgtcttcaaattcctca |
51120372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 75 - 112
Target Start/End: Complemental strand, 10616246 - 10616209
Alignment:
| Q |
75 |
tatttacctgatgaatgttgggaaagtatcttcaaatt |
112 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
10616246 |
tatttacctgatgagtgttgggaatgtatcttcaaatt |
10616209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 68 - 117
Target Start/End: Complemental strand, 554146 - 554097
Alignment:
| Q |
68 |
tgatttttatttacctgatgaatgttgggaaagtatcttcaaattcctca |
117 |
Q |
| |
|
||||||||| || |||||||||||||||||| | ||||||||||||||| |
|
|
| T |
554146 |
tgatttttactttcctgatgaatgttgggaatttgtcttcaaattcctca |
554097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 72 - 113
Target Start/End: Complemental strand, 566795 - 566754
Alignment:
| Q |
72 |
ttttatttacctgatgaatgttgggaaagtatcttcaaattc |
113 |
Q |
| |
|
||||||||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
566795 |
ttttatttacctgatgactgttgggaacgtgtcttcaaattc |
566754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 66 - 118
Target Start/End: Complemental strand, 642393 - 642341
Alignment:
| Q |
66 |
gctgatttttatttacctgatgaatgttgggaaagtatcttcaaattcctcaa |
118 |
Q |
| |
|
||||| |||||||||||||||||||||||||| | |||||||| || ||||| |
|
|
| T |
642393 |
gctgagttttatttacctgatgaatgttgggagtgcatcttcaattttctcaa |
642341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 121
Target Start/End: Original strand, 1537245 - 1537297
Alignment:
| Q |
69 |
gatttttatttacctgatgaatgttgggaaagtatcttcaaattcctcaacaa |
121 |
Q |
| |
|
||||| |||||||||||||| ||||||||| || | |||| |||||||||||| |
|
|
| T |
1537245 |
gatttatatttacctgatgagtgttgggaatgtgtattcagattcctcaacaa |
1537297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 70 - 119
Target Start/End: Original strand, 45244521 - 45244570
Alignment:
| Q |
70 |
atttttatttacctgatgaatgttgggaaagtatcttcaaattcctcaac |
119 |
Q |
| |
|
|||| |||||||||||||| ||||||||| || |||| |||||||||||| |
|
|
| T |
45244521 |
atttctatttacctgatgagtgttgggaatgtgtcttgaaattcctcaac |
45244570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 115
Target Start/End: Original strand, 41886296 - 41886336
Alignment:
| Q |
75 |
tatttacctgatgaatgttgggaaagtatcttcaaattcct |
115 |
Q |
| |
|
|||||||||||||| ||||||||| || ||||||||||||| |
|
|
| T |
41886296 |
tatttacctgatgagtgttgggaatgtgtcttcaaattcct |
41886336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University