View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19696_low_17 (Length: 201)
Name: NF19696_low_17
Description: NF19696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19696_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 50 - 89
Target Start/End: Original strand, 20385566 - 20385605
Alignment:
| Q |
50 |
tttcacatgtcaactctgtgattgccgtattccaattcca |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20385566 |
tttcacatgtcaactctgtgattgccgtattccaattcca |
20385605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 18 - 53
Target Start/End: Original strand, 20385491 - 20385526
Alignment:
| Q |
18 |
actttctattgaattccgaattcaattctatttttc |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20385491 |
actttctattgaattccgaattcaattctagttttc |
20385526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University