View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19696_low_17 (Length: 201)

Name: NF19696_low_17
Description: NF19696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19696_low_17
NF19696_low_17
[»] chr3 (2 HSPs)
chr3 (50-89)||(20385566-20385605)
chr3 (18-53)||(20385491-20385526)


Alignment Details
Target: chr3 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 50 - 89
Target Start/End: Original strand, 20385566 - 20385605
Alignment:
50 tttcacatgtcaactctgtgattgccgtattccaattcca 89  Q
    ||||||||||||||||||||||||||||||||||||||||    
20385566 tttcacatgtcaactctgtgattgccgtattccaattcca 20385605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 18 - 53
Target Start/End: Original strand, 20385491 - 20385526
Alignment:
18 actttctattgaattccgaattcaattctatttttc 53  Q
    |||||||||||||||||||||||||||||| |||||    
20385491 actttctattgaattccgaattcaattctagttttc 20385526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University