View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19697_high_11 (Length: 272)
Name: NF19697_high_11
Description: NF19697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19697_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 13 - 251
Target Start/End: Complemental strand, 46441595 - 46441356
Alignment:
| Q |
13 |
aatatcattcaaatttaaattgttcaaaatttcacttatatctagtttaattagaagtgaaacatcataattttcatgagcattattaaaagaacttcct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46441595 |
aatatcattcaaatttaaattgttcaaaatttcacttatatctagtttaattagaagtgaaacatcataattttcatgagcattattaaaagaacttcct |
46441496 |
T |
 |
| Q |
113 |
aattcattaacttggggcacacc-aacttgttgtaaaataattgggataaaattaggagcaaagtatacctcttcaggatgcaagtgagtaggaataaca |
211 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46441495 |
aattcattaacttggggcacaccaaacttgttgtaaaataattgggataaaattagtagcaaagtatacctcttctggatgcaagtgagtaggaataaca |
46441396 |
T |
 |
| Q |
212 |
ccagctccatgaatatttgcaagacataactcttgctcct |
251 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46441395 |
ccagctccatgaatatttgcaagatataactcttgctcct |
46441356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University