View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19697_high_17 (Length: 201)
Name: NF19697_high_17
Description: NF19697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19697_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 190
Target Start/End: Complemental strand, 2878574 - 2878402
Alignment:
| Q |
18 |
ctctactgttgaaagatatgattcttatatagaggcgagacaaatgaaatgagatagacatgccagacagaaatttcatattaggaaaaagaatgtaatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2878574 |
ctctactgttgaaagatatgattcttatatagaggcgagacaaatgaaatgagatagacatgccagacagaaatttcatattaggaaaaagaatataatt |
2878475 |
T |
 |
| Q |
118 |
taatatgaatttattgcaggttcatttttcatgaataaattaattcgagacaaattattttaatttatatatt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2878474 |
taatatgaatttattgcaggttcattttttatgaataaattaattcgagacaaattattttaatttatatatt |
2878402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University