View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19697_low_12 (Length: 272)

Name: NF19697_low_12
Description: NF19697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19697_low_12
NF19697_low_12
[»] chr1 (1 HSPs)
chr1 (13-251)||(46441356-46441595)


Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 13 - 251
Target Start/End: Complemental strand, 46441595 - 46441356
Alignment:
13 aatatcattcaaatttaaattgttcaaaatttcacttatatctagtttaattagaagtgaaacatcataattttcatgagcattattaaaagaacttcct 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46441595 aatatcattcaaatttaaattgttcaaaatttcacttatatctagtttaattagaagtgaaacatcataattttcatgagcattattaaaagaacttcct 46441496  T
113 aattcattaacttggggcacacc-aacttgttgtaaaataattgggataaaattaggagcaaagtatacctcttcaggatgcaagtgagtaggaataaca 211  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||    
46441495 aattcattaacttggggcacaccaaacttgttgtaaaataattgggataaaattagtagcaaagtatacctcttctggatgcaagtgagtaggaataaca 46441396  T
212 ccagctccatgaatatttgcaagacataactcttgctcct 251  Q
    |||||||||||||||||||||||| |||||||||||||||    
46441395 ccagctccatgaatatttgcaagatataactcttgctcct 46441356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University