View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19698_low_4 (Length: 278)
Name: NF19698_low_4
Description: NF19698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19698_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 11 - 275
Target Start/End: Original strand, 32035670 - 32035934
Alignment:
| Q |
11 |
aacataggcatcatgaaaaaagtggatcaaatggaactatagtggtacactaaaaagattaggggaaagacttcactctaaactaaatggatttattgat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32035670 |
aacataggcatcatgaaaaaagtggatcaaatggaactgtagtggtacactaaaaagattaggggaaagacttcactctaaactaaatggatttattgat |
32035769 |
T |
|
| Q |
111 |
ttttggttagaatctaatggaatcgactgatctatgtatctatccctactcggtacttggttattattttttacggccacaaaacacaacatagcaaatc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32035770 |
ttttggttagaatctaatggaatcgactgatctatgtatctatccctactcagtacttggttgttattttttacggccacaaaacacaacatagcaaatc |
32035869 |
T |
|
| Q |
211 |
atctctaacaggaagtccaaaaaacatgacggtcactatcaactaattgatattaacaatcataa |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32035870 |
atctctaacaggaagtccaaaaaacatgacggtcactatcaactaattgatattaacaatcataa |
32035934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University