View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19699_high_10 (Length: 329)
Name: NF19699_high_10
Description: NF19699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19699_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 99 - 313
Target Start/End: Original strand, 32036163 - 32036377
Alignment:
| Q |
99 |
caaagctacatatttccaaaccacgtcacaaaaccactcaagcaaacaaaaacattgcaatcttgagataagtaagtagatagaaaaactaacttgcagg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32036163 |
caaagctacatatttccaaaccacgtcacaaaaccactcaagcaaacaaaaacattgcaatcttgagataagtaagtagatagaaaaactaacttgcagg |
32036262 |
T |
 |
| Q |
199 |
aagtaaaatgggaggagattgagcaaatctaacatctccttgaggaggccgttgagttgtatgatatatacgactggtaaatccagtaaagaaattggaa |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32036263 |
aagtaaaatgggaggagattgagcaaatctaacatctccttgaggaggccgttgagttgtatgatatatacgactggtaaatccagtaaagaaattggaa |
32036362 |
T |
 |
| Q |
299 |
tgccatagttcactc |
313 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
32036363 |
tgccatagttcactc |
32036377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University