View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19699_high_11 (Length: 329)
Name: NF19699_high_11
Description: NF19699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19699_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 2 - 312
Target Start/End: Original strand, 52796111 - 52796421
Alignment:
| Q |
2 |
attacggggttgtgggtttggtactagccgttttggtatggatgtggttggcaatggtgatgaaacatataagagtgaaacttggtcatcagcttccacc |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52796111 |
attacggggttgtgggtttggtactagccgttttggtatggatttggttggcaatggtgatgaaacatataagagtgaaacttggtcatcagcttccacc |
52796210 |
T |
|
| Q |
102 |
tggaccaagatgttggccagtgattggcaacattttccagctaggtttgtcaccaccacacgagtcctttacaatactgtctcgtagacatggtcctatc |
201 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52796211 |
tggaccaagatgttggccagtggttggcaacattttccagctaggtttgtcaccaccacacgagtcctttacaatactgtctcgtagacatggtcctatc |
52796310 |
T |
|
| Q |
202 |
atgaccctttggctaggttccatgtgcaccgtagttgtctcttcctgtgaagcagcccgtgacatgttcaaaaacaacgatgcggctcttgcaggaagga |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52796311 |
atgaccctttggctaggttccatgtgcaccgtagttgtctcttcctgtgaagcagcccgtgacatgttcaaaaacaacgatgcggctcttgcaggaagga |
52796410 |
T |
|
| Q |
302 |
aggtttatgag |
312 |
Q |
| |
|
||||||||||| |
|
|
| T |
52796411 |
aggtttatgag |
52796421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University