View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19699_high_14 (Length: 271)

Name: NF19699_high_14
Description: NF19699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19699_high_14
NF19699_high_14
[»] chr3 (1 HSPs)
chr3 (39-254)||(22921707-22921917)


Alignment Details
Target: chr3 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 39 - 254
Target Start/End: Complemental strand, 22921917 - 22921707
Alignment:
39 atattcttggtttagatgtgaaatatatatcatttattaatataaatgtcctttcctttgtatggcttaatattacttacgtttaggttatgtttaaacc 138  Q
    |||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||    |||||||||||||||||||     
22921917 atattcttggtttagatgtgaaatatatatcatt-attaatattaatgtcctttcctttgtatggcttaatattac----gtttaggttatgtttaaact 22921823  T
139 gatggaatatgatgaaatgagataaaattaaatggaatggaacgagtttatgttccatattgtttagattgaaaatgagaggaggaaattgagtggaata 238  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22921822 gatggaatatgatgaaatgagataaaattaaatggaatggaacgagtttatgttccatattgtttagattgaaaatgagaggaggaaattgagtggaata 22921723  T
239 atgcatcccatcaata 254  Q
    ||||||||||||||||    
22921722 atgcatcccatcaata 22921707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University