View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19699_high_17 (Length: 253)
Name: NF19699_high_17
Description: NF19699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19699_high_17 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 253
Target Start/End: Original strand, 35197431 - 35197670
Alignment:
| Q |
18 |
ataagtggtagattctgttgttaaaagaccgtgtatgaccagtttccttactggatttttctatagctttgcttcttatggtctactttccaaggtgtga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35197431 |
ataagtggtagattctgttgttaaaagaccgtgtatgaccagtttccttactggatttttctatagctttgcttcttatggtctactttccaaggtgtga |
35197530 |
T |
|
| Q |
118 |
ctcttttactattgcttgctacttacttttcactatgatcgagtggtcaattattatgttaacaccaagatcaggtgcataaatatagcaaaataaacaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35197531 |
ctcttttactattgcttgctacttacttttcactatgatcgagtggtcaattattatgttaacaccaagatcaggtgcataaatatagcaaaataaacaa |
35197630 |
T |
|
| Q |
218 |
taatccatt----tctaaaattgggaaaatgaattcatgc |
253 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
35197631 |
taatccatttctatctaaaattgggaatatgaattcatgc |
35197670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University