View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19699_high_18 (Length: 248)
Name: NF19699_high_18
Description: NF19699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19699_high_18 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 8 - 248
Target Start/End: Complemental strand, 7228889 - 7228652
Alignment:
| Q |
8 |
attattctggttcaggctttcttctttatgaagtgcgtttgctttaacagataagtaggtcgttacatgttagacgtataacgaccaaatttcagtttga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7228889 |
attattctggttcaggctttcttctttatgaagtgcgtttgctttaacagataagtaggtcgttacatgttagacgtataacgaccaaatttcagtttgt |
7228790 |
T |
 |
| Q |
108 |
gtacatgatgatgatgatatacacatccatgtgcatgtgatagtacatagcatagaagtgccataaatcaactcaaattcaatttgggtgcttctttatc |
207 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7228789 |
gtacatgatgatgat---atacacatccatgtgcatgtgatagtacatagcataaaagtgccataaatcaactcaaattcaatttgggtgcttctttatc |
7228693 |
T |
 |
| Q |
208 |
atctttatcatatatagctcggtacggtctagggtatagtc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7228692 |
atctttatcatatatagctcggtacggtctagggtatagtc |
7228652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University