View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19699_low_25 (Length: 233)
Name: NF19699_low_25
Description: NF19699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19699_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 168 - 219
Target Start/End: Original strand, 51282503 - 51282554
Alignment:
| Q |
168 |
aagaatatctccatccttaaacccacatgatttttgtcattgggagtataat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
51282503 |
aagaatatctccatccttaaacccacatgatttttgtcattaggagtataat |
51282554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University