View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1969_high_33 (Length: 273)
Name: NF1969_high_33
Description: NF1969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1969_high_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 70 - 256
Target Start/End: Complemental strand, 44877976 - 44877790
Alignment:
| Q |
70 |
ctctgatggagtagtttgcaaatgaatacagacggtgatgtgagaacatttgatgatttttctgatgatgtatagttatgaatatccttctaaacatatc |
169 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44877976 |
ctctgttggagtagtttgcaaatgaatacagacggtgatgtgagaacatttgatgatttttctgatgatgtatagttatgaatatccttctaaacatatc |
44877877 |
T |
|
| Q |
170 |
tatccatgtacttccaagtgcgaatgaacaagattaaataggataaaagtttgnnnnnnnncttatattttgggacaaagaaaataa |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44877876 |
tatccatgtacttccaagtgcgaatgaacaagattaaataggataaaagtttaatttttttcttatattttgggacaaagaaaataa |
44877790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 44878075 - 44877999
Alignment:
| Q |
1 |
ctgagcttagtcagtcagatatgtttaaaagtcagatatgtttggttccccgtttagagatcctgaaagctctgatg |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44878075 |
ctgagcttagtcagtcagatatgtttaaaagtcagatatgtttggttccccgtttagagatcctgaaagctctgatg |
44877999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 105 - 139
Target Start/End: Original strand, 28921670 - 28921704
Alignment:
| Q |
105 |
tgatgtgagaacatttgatgatttttctgatgatg |
139 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
28921670 |
tgatatgagaacatttgatgatttttctgatgatg |
28921704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 105 - 139
Target Start/End: Original strand, 42892353 - 42892387
Alignment:
| Q |
105 |
tgatgtgagaacatttgatgatttttctgatgatg |
139 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
42892353 |
tgatatgagaacatttgatgatttttctgatgatg |
42892387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University