View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1969_high_34 (Length: 267)
Name: NF1969_high_34
Description: NF1969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1969_high_34 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 14 - 251
Target Start/End: Original strand, 4933059 - 4933296
Alignment:
| Q |
14 |
aggcaaatttgtcgtttcatctaatgcatctattgagccatgagacgagtccggcgacatagaatgtctctccttatccacttcatttttgtcattatta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4933059 |
aggcaaatttgtcgtttcatctaatgcatctattgagccataagacgagtccggcgacatagaatgtctctccttacccacttcatttttgtcattatta |
4933158 |
T |
|
| Q |
114 |
tgattcacctcttgaactggtggcaatgtcgtcgacgcgccgataaaatcactattctttggaaattcacctgatttactactgaatgcaaaaaattgat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4933159 |
tgattcacctcttgaactggtggcaatgtcgtcgatgtgccgataaaatcactattctttggaaattcacctgatttactactgaatgcaaaaaattgat |
4933258 |
T |
|
| Q |
214 |
cctttgagaaactgtagtttcccaaatgaagactaaac |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4933259 |
cctttgagaaactgtagtttcccaaatgaagactaaac |
4933296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University