View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1969_high_7 (Length: 459)
Name: NF1969_high_7
Description: NF1969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1969_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-122; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-122
Query Start/End: Original strand, 21 - 263
Target Start/End: Complemental strand, 4376434 - 4376193
Alignment:
| Q |
21 |
tacgtgtctttctaggtctcattctttgggtaggtaacggaataacacattaaaaacttgttcaaatcgtaaattgtttaagatgaaactacataaagct |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4376434 |
tacgtgtctttctaggtctcattctttgggtaggtaacggaataacacattaaaaacttgttcgaatcgtaaattgtttaagatgaaactacataaagct |
4376335 |
T |
 |
| Q |
121 |
ataatatttaatcatttagagatttagtggtgtaggtcaactttgaaattagctacattatgcattttgttgatgttgattgatggcgggaaggtgcaac |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
4376334 |
ataatatttaatcatttagagatttagtggtgtaggtcaac-ttgaaattagccacattatgcattttgttgatgttgattgatggcgggaaggtgctac |
4376236 |
T |
 |
| Q |
221 |
cttttattcttttggtgcaggtacctttttgatgaagatacta |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4376235 |
cttttattcttttggtgcaggtacctttttgatgaagatacta |
4376193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 329 - 454
Target Start/End: Complemental strand, 4376155 - 4376033
Alignment:
| Q |
329 |
ttatgaacaaaggagtgtattatgatgctgctcctcctttcagagtatcagtattcatattttcttcctttttaccaagagtgcaaacaatctcaaaaga |
428 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4376155 |
ttatgaacaaaggagtgtattatg---ctgcgtctcctttcagagtatcagtattcatattttcttcctttttaccaagagtgcaaacaatctcaaaaga |
4376059 |
T |
 |
| Q |
429 |
tcaaacacgtattcatgttcatttca |
454 |
Q |
| |
|
|||||||||||||||||||| ||||| |
|
|
| T |
4376058 |
tcaaacacgtattcatgttcttttca |
4376033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University