View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1969_low_12 (Length: 434)
Name: NF1969_low_12
Description: NF1969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1969_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 179 - 417
Target Start/End: Original strand, 4341261 - 4341499
Alignment:
| Q |
179 |
aaaagttggctatcgagggaaaagaatcaaaccacttaaatatcccaccgagcatcttattctacgtgggacttaaggaccctatagtagggccacccct |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4341261 |
aaaagttggctatcgagggaaaagaatcaaaccacttaaatatcccaccgagcatcttattctacgtgggacttaaggaccctatagtagggccacccct |
4341360 |
T |
 |
| Q |
279 |
tagaccgacgtctctacaaccccgttgtatgatgttttactcgaccttttcggtcaggctgtagtgtaggtagttctttctaagccaccgacaaataact |
378 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4341361 |
tagaccgacgtctctacaaccccgttgcatgatgttttactcgaccttttcggtcaagctgtagtgtaggtagttctttctaagccaccgacaaataact |
4341460 |
T |
 |
| Q |
379 |
ctaacaccaattgacaaatatttaacaacttgttgaatt |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4341461 |
ctaacaccaattgacaaatatttaacaacttgttgaatt |
4341499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 4341146 - 4341262
Alignment:
| Q |
1 |
aaactggaaaccatttcgctacatcatagcagcattatacactatgtgaaactagcaacttagattgaaggcgaatttggtgtatgatacgtgtaatatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
4341146 |
aaactggaaaccatttcgctacatcacagcagcattatacactatgtgaaactagcaacttagattgaaggcgaatttggtgtctgatacgtgttatatc |
4341245 |
T |
 |
| Q |
101 |
acacaacatgacaccaa |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
4341246 |
acacaacatgacaccaa |
4341262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 192 - 234
Target Start/End: Complemental strand, 8424788 - 8424746
Alignment:
| Q |
192 |
cgagggaaaagaatcaaaccacttaaatatcccaccgagcatc |
234 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
8424788 |
cgagggaaaagaatcaaaccacttaaatactccaccgaacatc |
8424746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University