View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1969_low_15 (Length: 401)
Name: NF1969_low_15
Description: NF1969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1969_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 290; Significance: 1e-162; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 290; E-Value: 1e-162
Query Start/End: Original strand, 14 - 362
Target Start/End: Complemental strand, 37949750 - 37949402
Alignment:
| Q |
14 |
atatttatgcatctaatggcccagaaacttgagcaacgtgggactctaaacagcttcaacagacacaactcagaaccatcaggttctgtacttcgggcag |
113 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| |||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37949750 |
atatttatgcatctaacggcccagaaacctgagcaacctgggactctaaacagctttaacagacgcaactcagaaccatcaggttctgtacttcgggcag |
37949651 |
T |
|
| Q |
114 |
aagacaaatcaccatttgtcacaggcttgcaatagttaattgtggcttgacagttaattacaagaccttttcgatttttcaatgtacagctttttgaata |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37949650 |
aagacaaatcaccatttgtcacaggcttgcaatagttaattgtgacttgacagttaattacaagaccttttcgatttttcaatgtacaactttttgaata |
37949551 |
T |
|
| Q |
214 |
agtttaaggatttattggttgagttatggaacagatacgaagtatcaaaactcttcttaagccttcttcctgcttgtgttaggcaaaggtgtttatttta |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37949550 |
agtttaaggatttattggttgagttatggaacagatacg-agtatcaaaactcttcctaagccttcttcctgcttgtgttaggtaaaggtgtttatttta |
37949452 |
T |
|
| Q |
314 |
tgtatgg-ctttttaacttgtagcgaatctcagttccatttctctttttt |
362 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37949451 |
ggtatggtttttttaacttgtagcgaatctcagttccatttctctttttt |
37949402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University