View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1969_low_35 (Length: 297)
Name: NF1969_low_35
Description: NF1969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1969_low_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 132 - 287
Target Start/End: Complemental strand, 31100935 - 31100780
Alignment:
| Q |
132 |
gttcaccgatgatcactctttgtcctcaccagcctcaagcgtcaaataaagagtgtctaattaaattttggtttgaccaatgcataatagtgcttcaaac |
231 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31100935 |
gttcaccgatgataactctttgtcctcaccagcctcaagcgtcaaataaagagtgtctaattaaattttggtttgaccaatgtataatagtgcttcaaac |
31100836 |
T |
|
| Q |
232 |
ctcagagtaattatattaacgctcagcgtgctttggacattctagaaatccctatg |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
31100835 |
ctcagagtaattatattaacgctcagcgtgctttggatattcaagaaatccctatg |
31100780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 18 - 114
Target Start/End: Complemental strand, 31101019 - 31100923
Alignment:
| Q |
18 |
atccctctcattttgatgtattttggttcattcatgcaccccctatctagaatcatgccaagagtttctcattgtacatgtcaagttcaccgatgat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31101019 |
atccctctcattttgatgtattttggttcattcatgcaccccctatctagaatcatgccaagagtttctcattgtacatgtcaagttcaccgatgat |
31100923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University