View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1969_low_36 (Length: 296)
Name: NF1969_low_36
Description: NF1969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1969_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 19 - 282
Target Start/End: Original strand, 44911005 - 44911268
Alignment:
| Q |
19 |
gtcaaaacctcagacatttgtggtctaaatttggcctcactaatacattgtaacgcaagaattgcagctgtataagccgccctttgtggatactgccctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44911005 |
gtcaaaacctcagacatttgtggtctaaatttggcctcactaatacattgtaacgcaagaattgcagctgtataagccgccctttgtggatactgccctt |
44911104 |
T |
 |
| Q |
119 |
gtaatcttgtgtccataatccgaaacaactttcttctatcacccaagtatggtcttgcccaatctaccagattatgttccgctcctgattttgttttatc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44911105 |
gtaatcttgtgtccataatccgaaacaactttcttctatcacccaagtatggtcttgcccaatctaccagattatgttccgctcctgattttgttttatc |
44911204 |
T |
 |
| Q |
219 |
aacagcattgcgccctgatagtagttccaatagcacaactccgaagctatagacatcgcacctt |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44911205 |
aacagcattgcgccctgatagtagttccaatagcacaactccgaagctatagacatcgcacctt |
44911268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University