View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1969_low_37 (Length: 288)
Name: NF1969_low_37
Description: NF1969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1969_low_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 1e-47; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 1 - 153
Target Start/End: Complemental strand, 25078491 - 25078338
Alignment:
| Q |
1 |
gattgaatgaaattactagtgttggggtcatgttcctctccgacacaccgtgttacatacaaatactgatgtcttgtttacttttatggggaacactacg |
100 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||| || |||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25078491 |
gattgaataaaattacgagtgttggggtcatgttcctctacgccacaccgtgt----tacaaatattgatgtcttgtttacttttatggggaacactaca |
25078396 |
T |
|
| Q |
101 |
ac-----ggttttgttttgtattgtatctaatatccatattaatttaatgttgtgcca |
153 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25078395 |
accatagggttttgttttgtattgtatctaatatccatattaatttaatgttgtgcca |
25078338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 201 - 272
Target Start/End: Complemental strand, 25078181 - 25078110
Alignment:
| Q |
201 |
tgttccttatatagatgagtactttcactgtggtgcatcacacggcaccacacataccattcaaatactatc |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25078181 |
tgttccttatatagatgagtactttcactgtggtacatcacacggcaccacacataccattcaaatactatc |
25078110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 174 - 202
Target Start/End: Complemental strand, 25078325 - 25078297
Alignment:
| Q |
174 |
tattttcaaatagtttgaaattaattttg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25078325 |
tattttcaaatagtttgaaattaattttg |
25078297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 211 - 265
Target Start/End: Complemental strand, 54617950 - 54617896
Alignment:
| Q |
211 |
atagatgagtactttcactgtggtgcatcacacggcaccacacataccattcaaa |
265 |
Q |
| |
|
||||||||| |||||||| |||||||||| || ||||||||||||||||||||| |
|
|
| T |
54617950 |
atagatgagcactttcaccatggtgcatcatactgcaccacacataccattcaaa |
54617896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University