View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1969_low_43 (Length: 259)
Name: NF1969_low_43
Description: NF1969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1969_low_43 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 20 - 244
Target Start/End: Complemental strand, 3884459 - 3884235
Alignment:
| Q |
20 |
aatcgctataaccattatcatggtatacaccaccattacttgtaaagaaagggatgaagtaattgcttcgatgacacaatgatcggtgacacctagaatt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3884459 |
aatcgctataaccattatcatggtatacaccaccattacttgtaaagaaagggatgaagtaattgcttccatgacacaatgatcggtgacacctagaatt |
3884360 |
T |
 |
| Q |
120 |
agttttgaaaaggttcaaattagcttaatcaacccaataatatcacatcaactctaactaaaccctttccattcaaggaaaataataattgatttagcat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3884359 |
agttttgaaaaggttcaaattagcttaatcaacccaataatatcacatcaactctaactaaaccctttccattcaaggaaaataataattgatttagcat |
3884260 |
T |
 |
| Q |
220 |
aaagatacatgcccacatgccacag |
244 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
3884259 |
aaagatgcatgcccacatgccacag |
3884235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University