View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1969_low_45 (Length: 254)
Name: NF1969_low_45
Description: NF1969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1969_low_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 9696275 - 9696489
Alignment:
| Q |
1 |
ttttcttcattatattctatactagaatacaaactttggccaacattcaagnnnnnnnnnnnnnnncataaggacaagtaatcttgaattaaagaagata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9696275 |
ttttcttcattatattctatactagaatacaagctttggccaacattcaagttttttgtattttttcataaggacaagtaatcttgaattaaagaagata |
9696374 |
T |
 |
| Q |
101 |
aattggagttgattcactggaatgtaaatgggagtctatatatagcaccagctacaagtttataaaaatatctaggtaggtaactcgtgctactaataaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9696375 |
aattggagttgattcactggaatgtaaatgagagtctatatatagcaccagctacaagtttataaaaatatctaggtaggtaactcgtgcaactaataaa |
9696474 |
T |
 |
| Q |
201 |
ctaaacgggattagt |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
9696475 |
ctaaacgggattagt |
9696489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University