View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1969_low_48 (Length: 251)
Name: NF1969_low_48
Description: NF1969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1969_low_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 95 - 242
Target Start/End: Complemental strand, 9617523 - 9617377
Alignment:
| Q |
95 |
gtttaaaaatatattgagccgacatgcattcaaattcaattgaagtcaaaatnnnnnnngtgatgcatgttgcaagcaaaagtgcaaatgcaaaacaaac |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9617523 |
gtttaaaaatatattgagccgacatgcattcaaattcaattgaagtcaaaataaaaaa-gtgatgcttgttgcaagcaaaagtgcaaatgcaaaacaaac |
9617425 |
T |
 |
| Q |
195 |
cattggaggtgatagttgtatgaacagcaatgctagctatagcctatg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9617424 |
cattggaggtgatagttgtatgaacagcaatgctagctatagcctatg |
9617377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University