View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1969_low_57 (Length: 247)
Name: NF1969_low_57
Description: NF1969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1969_low_57 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 22634452 - 22634528
Alignment:
| Q |
1 |
aaaatttcaaacttctcagttgctttttgggtggtgtgtgttttgcttttatcaggaaaaagcaagtgaaatgatac |
77 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22634452 |
aaaatttcaaacttctcagttgcttttttggtggtgagtgttttgcttttatcaggaaaaagcaagtgaaatgatac |
22634528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 162 - 233
Target Start/End: Original strand, 22634613 - 22634684
Alignment:
| Q |
162 |
aacaggaaaaagcagagtgctttgcatcnnnnnnnnctactttaattaaaactcttccactcgttacttttg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22634613 |
aacaggaaaaagcagagtgctttgcatcttttttttctactttaattaaaactcttccactcgttacttttg |
22634684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University