View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1969_low_57 (Length: 247)

Name: NF1969_low_57
Description: NF1969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1969_low_57
NF1969_low_57
[»] chr7 (2 HSPs)
chr7 (1-77)||(22634452-22634528)
chr7 (162-233)||(22634613-22634684)


Alignment Details
Target: chr7 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 22634452 - 22634528
Alignment:
1 aaaatttcaaacttctcagttgctttttgggtggtgtgtgttttgcttttatcaggaaaaagcaagtgaaatgatac 77  Q
    |||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||    
22634452 aaaatttcaaacttctcagttgcttttttggtggtgagtgttttgcttttatcaggaaaaagcaagtgaaatgatac 22634528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 162 - 233
Target Start/End: Original strand, 22634613 - 22634684
Alignment:
162 aacaggaaaaagcagagtgctttgcatcnnnnnnnnctactttaattaaaactcttccactcgttacttttg 233  Q
    ||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||    
22634613 aacaggaaaaagcagagtgctttgcatcttttttttctactttaattaaaactcttccactcgttacttttg 22634684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University