View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1969_low_58 (Length: 245)
Name: NF1969_low_58
Description: NF1969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1969_low_58 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 21 - 227
Target Start/End: Original strand, 485831 - 486037
Alignment:
| Q |
21 |
aacatgttaacccttgtcctaattcacccttcaccttcaccctatccgactcaactctaaaagttaacaaccacgtcatcctctctgatgtccccaaaaa |
120 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
485831 |
aacatgttaacccttgtcccaattcacccttcaccttcaccctatccgactcaactctaaaagttaacaaccacgtcatcctctctgatgtccccaaaaa |
485930 |
T |
 |
| Q |
121 |
catcaccaccactatcactccgtccaccaccgtcaccgcaaccaacggttgcttccttggttttgaagccaatgaagtgaaaagccgccatgttgcacac |
220 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
485931 |
catcaccaccactaccactccgtccaccaccgtcaccgcaaccaacggttgcttccttggttttgaagccaacgaagcgaaaagccgccatgttgcacac |
486030 |
T |
 |
| Q |
221 |
attggaa |
227 |
Q |
| |
|
||||||| |
|
|
| T |
486031 |
attggaa |
486037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University