View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1969_low_6 (Length: 487)
Name: NF1969_low_6
Description: NF1969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1969_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 254 - 468
Target Start/End: Original strand, 28452794 - 28453011
Alignment:
| Q |
254 |
ttggcaaaggagtaaattgaaaggagaagaaatttgtgagtttgtgaaagtacaaatgttgttgtcctccattgtgcaaatcccccatttgtttcttcga |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28452794 |
ttggcaaaggagtaaattgaaaggagaagaaatttgtgagtttgtgaaagtacaaatgttgttgtcctccattgtgcaaatcccccatttgtttcttcga |
28452893 |
T |
|
| Q |
354 |
cattcttcaacaacaccactccgaatccgatcaatctg---ctcctcctccttcatcaaggtcagtatcaaattgttctcactttctctgtcttacccac |
450 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28452894 |
cattcttcaacaacaccactccgaatccgatcaatctgctcctcctcctccttcatcaaggtcagtatcaaattgttctcactttctctctcttacccac |
28452993 |
T |
|
| Q |
451 |
ttcttcactttccttctc |
468 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
28452994 |
ttcttcactttccttctc |
28453011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 49 - 103
Target Start/End: Original strand, 28452586 - 28452639
Alignment:
| Q |
49 |
catacttgatctaaacaaaatatgagtatggatggaggaattgaaagtgtgggtt |
103 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28452586 |
catacttaatctaaacaaaatatgagta-ggatggaggaattgaaagtgtgggtt |
28452639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University