View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1969_low_62 (Length: 238)
Name: NF1969_low_62
Description: NF1969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1969_low_62 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 8 - 228
Target Start/End: Original strand, 41163153 - 41163373
Alignment:
| Q |
8 |
gactgatgcgaatacacagataattaccatgtgtaactgaaagaggtgtttcagtagtcgaactcctgcaactgagctccgccacaaaaaattcggaggt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| ||||||||||| |||| |
|
|
| T |
41163153 |
gactgatgcgaatacacagataattaccatgtgtaactgaaagaggtgtttcagtagtcgaactcttgcaaccgagctccgccgcaaaaaattcgaaggt |
41163252 |
T |
|
| Q |
108 |
gcaaaatacaccgatgaggaaggaatctgtgtgaatcaaatgccatctgaaatcgccgttgtgaccagaattgtatggaaactatgagacttggaacaac |
207 |
Q |
| |
|
||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
41163253 |
gcagaatacactgatgaggaaggaatctgtgtgaatcaaatgccatctgaaatcgccgttgtgaccggaattgtaaggaaactatgagacttggaacaac |
41163352 |
T |
|
| Q |
208 |
acccgcaactctttatctctg |
228 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
41163353 |
acccgcaactctttatctctg |
41163373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University