View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1969_low_72 (Length: 222)
Name: NF1969_low_72
Description: NF1969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1969_low_72 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 17 - 159
Target Start/End: Complemental strand, 37178190 - 37178048
Alignment:
| Q |
17 |
gagaagatgggggaatcaggggaggctggtatgtcaatttccaactattcaaatcaagtggttaggcagaatacatttaaagaaagtatccgtggagaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37178190 |
gagaagatgggggaatcaggggaggctggtatgtcaatttccaactattcaaatcaagtggttaggcagaatacatttaaagaaagtatccgtggagaaa |
37178091 |
T |
 |
| Q |
117 |
gggagcctaattatgacaattttgtttcaaggtctggatgttc |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37178090 |
gggagcctaattatgacaattttgtttcaaggtctggatgttc |
37178048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 204
Target Start/End: Complemental strand, 37173525 - 37173475
Alignment:
| Q |
154 |
atgttcatccccgtctttgtcttcctggctcaaactgactgacttggttgc |
204 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37173525 |
atgttcatccccatctttgtcttcctggctcaaactgactgacttggttgc |
37173475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University