View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19700_low_15 (Length: 315)
Name: NF19700_low_15
Description: NF19700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19700_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-146; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 5 - 299
Target Start/End: Complemental strand, 37598251 - 37597948
Alignment:
| Q |
5 |
ttctcctacaaagagaactagttgaagaggctcttgaatattgatcaaaccttatttattgccagattatctatttgtggtcctacatttagtctttgta |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37598251 |
ttctcctacaaagagaactagttgaagaggctcttgaatattgatcaaaccttatttattgccagattatctatttgtggtcctacatttagtctttgta |
37598152 |
T |
 |
| Q |
105 |
gtgtacttcctctaaagtgctggaaagtttataagttactgttaagtgttaaggttttggaagaactttttgaaggattgactgattccactggtccttg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37598151 |
gtgtacttcctctaaagtgctggaaagtttataagttactgttaagtgttaaggttttggaagaactttttgaaggattgactgattccactggtccttg |
37598052 |
T |
 |
| Q |
205 |
tatttaattttgctgatg---gtagatgcaatatggaaagagactcctaacgcactg------atatgcactagaaatatcgttacagttttgatgggcc |
295 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37598051 |
tatttaattttgctgatggtagtagatgcaatatggaaagagactcctaacgcactgatatatatatgcactagaaatatcgtaacagttttgatgggcc |
37597952 |
T |
 |
| Q |
296 |
atac |
299 |
Q |
| |
|
|||| |
|
|
| T |
37597951 |
atac |
37597948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 21 - 55
Target Start/End: Complemental strand, 37602757 - 37602723
Alignment:
| Q |
21 |
actagttgaagaggctcttgaatattgatcaaacc |
55 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37602757 |
actagttgaagaggctcttgaatattggtcaaacc |
37602723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University